NIAB - National Institute of Agricultural Botany

Assay information: Vf_Mt7g024540_001

Export assay as CSV

Narrative Geranylgeranyl transferase type-1 subunit beta (AHRD V1 ***- Q5EAD5); contains Interpro domain(s) IPR008930 Terpenoid cylases/protein prenyltransferase alpha-alpha toroid chr07_pseudomolecule_IMGAG_V3.5 6556314-6544623 E EGN_Mt100125 20100825
References Webb, A., Cottage, A., Wood, T., Khamassi, K., Hobbs, D., Gostkiewicz, K., White, M., Khazaei, H., Ali, M., Street, D., Duc, G., Stoddard, F., Maalouf, F., Ogbonnaya, F. C., Link, W., Thomas, J. and O'Sullivan, D. M. (2015) A SNP-based consensus genetic map for synteny-based trait targeting in faba bean (Vicia faba L.). Plant Biotechnology Journal. ISSN 1467-7652 (In Press)
Map NV13 x Memphis
Linkage Group 8
Chromosome unknown
cM position 21.3142
Assay ID
Assay Name Vf_Mt7g024540_001
Reference Allele Sequences
Sequence ID Allele Phenotype
T:T resistant
C:C susceptible
Polymorphism sequence GGTGGTGCAACTTAYTGTGCTATTGCGTCTCTCCGGTTAATGGGATTTAT[Y]GA
AGACAATATTCTCTCAAGTTGTAATTTGTCTTCTTTGATAGATTTCCCATTGCTG
TTGGACTGGATCTTGCAG
Reference allele sequence alignment
Validation plot
Genotype data