NIAB - National Institute of Agricultural Botany

Assay information: Vf_Mt3g088610_001

Export assay as CSV

Narrative Delta-aminolevulinic acid dehydratase, chloroplastic (AHRD V1 ***- P43210); contains Interpro domain(s) IPR001731 Tetrapyrrole biosynthesis, porphobilinogen synthase chr03_pseudomolecule_IMGAG_V3.5 29441868-29436474 E EGN_Mt100125 20100825
References Webb, A., Cottage, A., Wood, T., Khamassi, K., Hobbs, D., Gostkiewicz, K., White, M., Khazaei, H., Ali, M., Street, D., Duc, G., Stoddard, F., Maalouf, F., Ogbonnaya, F. C., Link, W., Thomas, J. and O'Sullivan, D. M. (2015) A SNP-based consensus genetic map for synteny-based trait targeting in faba bean (Vicia faba L.). Plant Biotechnology Journal. ISSN 1467-7652 (In Press)
Map NV13 x Memphis
Linkage Group 2
Chromosome unknown
cM position 108.227
Assay ID
Assay Name Vf_Mt3g088610_001
Reference Allele Sequences
Sequence ID Allele Phenotype
A:A resistant
G:G susceptible
Polymorphism sequence CTTCTTCAACCATTCCAAACACACCYTTAACCTTGAGTTCCCACATCTACGTAGA
TCTCAAATCACCACTGACATTATCCAACTATCTCAGCTTCTCTTC[R]TCAAAGC
GCCGACAACCTCCAAGTCTTTTCACGGTCAGAGCTAGTGACTCAGATTTCGAAGC
CGCGGTTGTTGCCGGTAA
Reference allele sequence alignment
Validation plot
Genotype data