| Narrative | Potyvirus VPg interacting protein (AHRD V1 ***- B0ZZ79_ARAHY); contains Interpro domain(s) IPR004082 Protein of unknown function DUF1423, plant chr05_pseudomolecule_IMGAG_V3.5 41607135-41610779 E EGN_Mt100125 20100825 | |||||||||
| References | Webb, A., Cottage, A., Wood, T., Khamassi, K., Hobbs, D., Gostkiewicz, K., White, M., Khazaei, H., Ali, M., Street, D., Duc, G., Stoddard, F., Maalouf, F., Ogbonnaya, F. C., Link, W., Thomas, J. and O'Sullivan, D. M. (2015) A SNP-based consensus genetic map for synteny-based trait targeting in faba bean (Vicia faba L.). Plant Biotechnology Journal. ISSN 1467-7652 (In Press) | |||||||||
| Map | NV13 x Memphis | |||||||||
| Linkage Group | 1 | |||||||||
| Chromosome | unknown | |||||||||
| cM position | 196.084 | |||||||||
| Assay ID | ||||||||||
| Assay Name | Vf_Mt5g097360_001 | |||||||||
| Reference Allele Sequences |
|
|||||||||
| Polymorphism sequence |
CCTCCACGACAGCAGTCTCGGGTTGGAGGATTGCAAACATCTCTATCTCTGGTTC CTTTGGATCCGCGCTTGTCTCCTGAGGATCCTAGGTC[R]AATTCTGATAATCTT CGAGAATCTCCTACKGAAAGTGCTAGTTCTAGAGAAACCTGGCCTACTGCTGATG CAATTGCTGCAAAGAAGATGGAGAA |
|||||||||
| Reference allele sequence alignment | ||||||||||
| Validation plot | ||||||||||
| Genotype data |