NIAB - National Institute of Agricultural Botany

Assay information: Vf_Mt5g080450_001

Export assay as CSV

Narrative Ribulose-1 5-bisphosphate carboxylase/oxygenase activase 1 (AHRD V1 **** Q9AXG1_GOSHI); contains Interpro domain(s) IPR003959 ATPase, AAA-type, core chr05_pseudomolecule_IMGAG_V3.5 33426437-33421550 E EGN_Mt100125 20100825
References Webb, A., Cottage, A., Wood, T., Khamassi, K., Hobbs, D., Gostkiewicz, K., White, M., Khazaei, H., Ali, M., Street, D., Duc, G., Stoddard, F., Maalouf, F., Ogbonnaya, F. C., Link, W., Thomas, J. and O'Sullivan, D. M. (2015) A SNP-based consensus genetic map for synteny-based trait targeting in faba bean (Vicia faba L.). Plant Biotechnology Journal. ISSN 1467-7652 (In Press)
Map NV13 x Memphis
Linkage Group 1
Chromosome unknown
cM position 160.23
Assay ID
Assay Name Vf_Mt5g080450_001
Reference Allele Sequences
Sequence ID Allele Phenotype
A:A resistant
C:C susceptible
Polymorphism sequence TTCGACCCAACTGCTAGAAGTGATGATGGAACATGCTTATACACATTTGAATAAT
CTAAGGATTCTCCTATTAGGTTAAGTTAAGGAGGAGAAGCTGAGA[M]TTTAGAT
AATAAATCGAATAATTTTATCATCTTGTTAAAATATTGGATTGTTGTTGT
Reference allele sequence alignment
Validation plot
Genotype data