| Narrative | 
			This KASP assay belongs to a set of 67 validated assays designed to recapitulate polymorphisms targeted by SNPshot or CAPS assays as described in Ellwood et al, BMC Genomics (2008). Further details of the validation of this set of KASP assays can be found in Cottage et al, Mol Breeding (2012) and the related online supplementary data. The assay has been integrated into a consensus map with 653 new markers. Details in Webb et al.,Plant Biotechnology Journal (2015). | 
		
		
			| References | 
			Cottage A, Gostkiewicz K, Thomas JE, Borrows R, Torres A-M, and O Sullivan D.M. (2012) Heterozygosity and diversity analysis using mapped SNPs in a faba bean inbreeding programme. Molecular Breeding 30 (4). pp. 1799-1809. ISSN 1572-9788 doi: 10.1007/s11032-012-9745-4 . Ellwood S, Phan H, Jordan M, Hane J, Torres A, Avila C, Cruz-Izquierdo S, Oliver R (2008) Construction of a comparative genetic map in faba bean (Vicia faba L.); conservation of genome structure with Lens culinaris. BMC Genetics 9:380. | 
		
		
			| Map | 
			2015 consensus map | 
		
		
			| Linkage Group | 
			Vf_Chr_3 B | 
		
		
			| Chromosome | 
			unknown | 
		
		
			| cM position | 
			114.71 | 
		
		
			| Assay ID | 
			972-0072 | 
		
		
			| Assay Name | 
			REPSNP | 
		
		
			| Reference Allele Sequences | 
							
					
						| Sequence ID | 
						Allele | 
						Phenotype | 
					 
											
							| FH893750 | 
							C | 
							NA | 
						 
											
							| FH893867 | 
							T | 
							NA | 
						 
									 
							 | 
		
		
			| Polymorphism sequence | 
			
				TTCAAGAACGGAACCGCTCTTAACACTACTCCCAAGGCTTCAATTTCTCACGATC AACCTGTAAGTAATGCCTTCAATATCATGTGTTAGGGTTAGGGTTGAACTTTACG TTTAAT[Y]CGATTGTAATTSTTTCTTGTTATAGGTTTTGTGCTCTGCTTGGAAA GATGATGGAACAACCGTTTTTTCTGGAGGTTGTGATAAGCAGGTCAAGATGTGGC CACTTTTGTCCGGAGGGCAGCCAGTGACGGTTGCC 			 | 
		
		
			| Reference allele sequence alignment | 
			
                        			 | 
		
		
			| Validation plot | 
			
				 | 
		
		
			| Genotype data | 
							
					
						| Accession Name | 
						Other Ref | 
						Genotype call (with filter) | 
                                                Reference sample of known genotype | 
					 
					                                                
                        						
							 | 
							Verde_Bonita | 
							T:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							VF27 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig11749-5/S1 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig11903-1/S2 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig11903-1/S3 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig12137-2/S2 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig12137-2/S3 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig11276-1/S1 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig12159-1/S1 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig12159-1/S2 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig12263-1/S1 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig12263-1/S2 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig12613-2/S2 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig12613-2/S3 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig12658-1/S1 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig12658-1DW/S2 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig12747-1/S1 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig12747-2DW/S1 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig12747-2/S2 | 
							? | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig13004-1/S1 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig11290-1/S1 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig11290-1/S2 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig14096-5/S1 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig14189-1/S2 | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig14189-1/S3 | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig14197-2/S1 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig14197-2/S2 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig70718-5/S1 | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig72355-5/S1 | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig72423-1/S1 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig72423-1/S2 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig72495-1/S2 | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig124126-1/S1 | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig124126-1/S2 | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig124126-2/S1 | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig124126-2/S2 | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig124213-3/S1 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig124300-1/S1 | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig124301-1/S1 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig11531-5/S1 | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig130596-2/S1 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig130596-2/S2 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig130638-1/S1 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig130674-1/S1 | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig130734-2/S1 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig131693-1/S1 | 
							T:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig131693-1/S2 | 
							T:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig132660-2/S2 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig132813-2/S1 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							Borington Bulk-1 | 
							T:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							Borington Bulk-1/S1 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							V219-4/S1 | 
							? | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							V220-3/S1 | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NA1-2/S1 | 
							T:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NA12-1/S1 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							Vf172-1 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							Vf172-1/S1 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							GLV45-2/S1 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							Hedin/2-1 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							Hedin/2-1/S1 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							Maris Bead-3 | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							Maris Bead-3/S1 | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							Fuego-4 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							Fuego-4/S1 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							Granit-1 | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							Granit-1/S1 | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							Albus-1 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							Kasztelan-1 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig101760-3  (BPL1) | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig101760-3/S1  (BPL1) | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig101769-1/S1 (BPL10) | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig101769-1/S2 (BPL10) | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig101770-1/S1 (BPL11) | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig101770-1/S2 (BPL11) | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig101771-4/S1B1 (BPL12) | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig101771-3 (BPL12) | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig101780-3/S1 (BPL21) | 
							T:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig101782-3 (BPL23) | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig101782-3/S1 (BPL23) | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig101786-2/S1 (BPL27) | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig101786-2/S2 (BPL27) | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig101799-1/S1 (BPL40) | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig101799-1/S3 (BPL40) | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig101822-2/S1 | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig101822-2/S2  (BPL63) | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig101942-3 (BPL183) | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig101942-3/S1 (BPL183) | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							CGN07715 cf-3-2 (60354-9) | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							CGN07715 cf-3-2 (60354-9)-1/S1A1 | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							FAB4000104-13-1 | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							FAB4000104-13-1/S1 | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							Vf6-1/S1 | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							Vf136-1/S1 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							INRA29H-1/S1 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig11656-6/S1 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig11687-7/S1 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							ig11695-5/S1 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NV153_1DW_S3A2 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NV639_1_HEDIN | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NV643_3_S2 | 
							? | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NV644_1_KASZTEL | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NV648_2_S3B2_7 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NV656_3_S2A2_9 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NV657_26 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NV658_2_CGN0771 | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NV662_1_VF136 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NV713_1_COTEDOR | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NV714_1_HIVERNA | 
							? | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NV715_1_WEBO | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NV716_1_WIBO | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NV717_1_L79_79 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NV718_1_L977_88 | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NV719_1_L979_S1 | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NV720_1_BOURDON | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NV721_1_ARRISOT | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NV722_1_BANNER | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NV723_1_BULLDOG | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NV724_1_PIETRAL | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NV725_1_GIZA3_2 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NV726_1_GIZA402 | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NV727_1_BPL4628 | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NV728_1_TW | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NV729_1_VF6 | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NV730_1_I4347_4 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NV731_1_I4347_3 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NV732_1_BPL710 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NV733_1_NA112 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NV734_1_ILB938 | 
							C:C | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NV735_1_MELODIE | 
							T:T | 
                            
                                                             | 
						 
					                                                
                        						
							 | 
							NV736_1_AURORA | 
							T:T | 
                            
                                                             | 
						 
									 
							 |