NIAB - National Institute of Agricultural Botany

Assay information: Vf_Mt4g125110_001

Export assay as CSV

Narrative Ubiquinone biosynthesis protein COQ9, mitochondrial (AHRD V1 ***- Q5RJV0); contains Interpro domain(s) IPR012762 Ubiquinone biosynthesis protein COQ9 chr04_pseudomolecule_IMGAG_V3.5 43814816-43811358 E EGN_Mt100125 20100825
References Webb, A., Cottage, A., Wood, T., Khamassi, K., Hobbs, D., Gostkiewicz, K., White, M., Khazaei, H., Ali, M., Street, D., Duc, G., Stoddard, F., Maalouf, F., Ogbonnaya, F. C., Link, W., Thomas, J. and O'Sullivan, D. M. (2015) A SNP-based consensus genetic map for synteny-based trait targeting in faba bean (Vicia faba L.). Plant Biotechnology Journal. ISSN 1467-7652 (In Press)
Map NV13 x Memphis
Linkage Group 7
Chromosome unknown
cM position 44.1707
Assay ID
Assay Name Vf_Mt4g125110_001
Reference Allele Sequences
Sequence ID Allele Phenotype
T:T resistant
C:C susceptible
Polymorphism sequence CAGGCACAACCAGTAAATGTTCCAACGAGTTTTAAGCAGAGGGCAATGCTTGTGG
ATGAGATCTGGCATGTTG[Y]TGGTGATAATGCTTCTGACATYGATTGGTATGCC
AAGCGCACTGTCCTTGGAGGAGTATACTCAACAACGGAGATTTATATG
Reference allele sequence alignment
Validation plot
Genotype data