Narrative | none | |||||||||
References | Cottage A, Gostkiewicz K, Thomas JE, Borrows R, Torres A-M, and O Sullivan D.M. (2012) Heterozygosity and diversity analysis using mapped SNPs in a faba bean inbreeding programme. Molecular Breeding 30 (4). pp. 1799-1809. ISSN 1572-9788 doi: 10.1007/s11032-012-9745-4 . Ellwood S, Phan H, Jordan M, Hane J, Torres A, Avila C, Cruz-Izquierdo S, Oliver R (2008) Construction of a comparative genetic map in faba bean (Vicia faba L.); conservation of genome structure with Lens culinaris. BMC Genetics 9:380. | |||||||||
Map | NV13 x Memphis | |||||||||
Linkage Group | 6 | |||||||||
Chromosome | unknown | |||||||||
cM position | 66.2356 | |||||||||
Assay ID | ||||||||||
Assay Name | GLIP253SNP | |||||||||
Reference Allele Sequences |
|
|||||||||
Polymorphism sequence |
AACTTGGCTATGGAGAGCAGGGTTCCCCACCAACTATTCCAGGTAATTTATCGCA TTGATAAYGATAATAATGCTCAAGAG[Y]CAAAACCTCTTATATTAAGATAGTGA AATTATTATCTAACAGCTAGAAAATCTGGTTGCNTTGCTTATATAACGTTG |
|||||||||
Reference allele sequence alignment | ||||||||||
Validation plot | ||||||||||
Genotype data |