NIAB - National Institute of Agricultural Botany

Assay information: Vf_Mt4g061070_001

Export assay as CSV

Narrative Arogenate/prephenate dehydratase (AHRD V1 **** B9HM73_POPTR); contains Interpro domain(s) IPR001086 Prephenate dehydratase chr04_pseudomolecule_IMGAG_V3.5 18924658-18930635 E EGN_Mt100125 20100825
References Webb, A., Cottage, A., Wood, T., Khamassi, K., Hobbs, D., Gostkiewicz, K., White, M., Khazaei, H., Ali, M., Street, D., Duc, G., Stoddard, F., Maalouf, F., Ogbonnaya, F. C., Link, W., Thomas, J. and O'Sullivan, D. M. (2015) A SNP-based consensus genetic map for synteny-based trait targeting in faba bean (Vicia faba L.). Plant Biotechnology Journal. ISSN 1467-7652 (In Press)
Map NV13 x Memphis
Linkage Group 3
Chromosome unknown
cM position 109.063
Assay ID
Assay Name Vf_Mt4g061070_001
Reference Allele Sequences
Sequence ID Allele Phenotype
T:T resistant
C:C susceptible
Polymorphism sequence ATTGAGAATTCTTTAGGAGGGAGCATCCATAGGAATTATGATCTTTTACTCAGGC
ACAGGCTACATATTGTAGGAGAAGTAAAATATGCAGTCCATCA[Y]TGTTTGATG
GCCAACCATGGTATTAGACTTGAGAATTTGAAGCGCGTTCTTAGTCATCCTCAGG
Reference allele sequence alignment
Validation plot
Genotype data