NIAB - National Institute of Agricultural Botany

Assay information: Vf_Mt8g086470_001

Export assay as CSV

Narrative Cysteine proteinase 2 (Fragment) (AHRD V1 *--- P32955); contains Interpro domain(s) IPR013128 Peptidase C1A, papain chr08_pseudomolecule_IMGAG_V3.5 23855826-23857758 E EGN_Mt100125 20100825
References Webb, A., Cottage, A., Wood, T., Khamassi, K., Hobbs, D., Gostkiewicz, K., White, M., Khazaei, H., Ali, M., Street, D., Duc, G., Stoddard, F., Maalouf, F., Ogbonnaya, F. C., Link, W., Thomas, J. and O'Sullivan, D. M. (2015) A SNP-based consensus genetic map for synteny-based trait targeting in faba bean (Vicia faba L.). Plant Biotechnology Journal. ISSN 1467-7652 (In Press)
Map NV13 x Memphis
Linkage Group 3
Chromosome unknown
cM position 24.0085
Assay ID
Assay Name Vf_Mt8g086470_001
Reference Allele Sequences
Sequence ID Allele Phenotype
A:A resistant
C:C susceptible
Polymorphism sequence GAGGAAAAAGCAAAGAGATTTGAGACATTCAAAAGTAATCTTAAGCATATCAATG
AGATGAATGCAAAGAGAAAATCAC[M]AASTCAACATCGTTTRAGTCTCAACAAG
TTTGCTGATATGAGTCCTGAAGAGTTCAGTAAAACCTACTTAC
Reference allele sequence alignment
Validation plot
Genotype data