NIAB - National Institute of Agricultural Botany

Assay information: Vf_Mt4g025120_001

Export assay as CSV

Narrative none
References Webb, A., Cottage, A., Wood, T., Khamassi, K., Hobbs, D., Gostkiewicz, K., White, M., Khazaei, H., Ali, M., Street, D., Duc, G., Stoddard, F., Maalouf, F., Ogbonnaya, F. C., Link, W., Thomas, J. and O'Sullivan, D. M. (2015) A SNP-based consensus genetic map for synteny-based trait targeting in faba bean (Vicia faba L.). Plant Biotechnology Journal. ISSN 1467-7652 (In Press)
Map NV13 x Memphis
Linkage Group 2
Chromosome unknown
cM position 206.43
Assay ID
Assay Name Vf_Mt4g025120_001
Reference Allele Sequences
Sequence ID Allele Phenotype
C:C resistant
T:T susceptible
Polymorphism sequence GTGCATCAGTTACTTGGGTTAAAAGGGTCAACCTTCCAAAGCCTATATCATTTTA
CTGT[Y]GGAAGTCCTGTCGTGGACAAGCGTATAATGAGCTTACCGGCCTATCCA
GGSCCCGA
Reference allele sequence alignment
Validation plot
Genotype data