NIAB - National Institute of Agricultural Botany

Assay information: Vf_Mt5g027980_001

Export assay as CSV

Narrative Pentatricopeptide repeat-containing protein At1g31920 (AHRD V1 ***- Q9C6T2); contains Interpro domain(s) IPR002885 Pentatricopeptide repeat chr05_pseudomolecule_IMGAG_V3.5 11448413-11450548 E EGN_Mt100125 20100825
References Webb, A., Cottage, A., Wood, T., Khamassi, K., Hobbs, D., Gostkiewicz, K., White, M., Khazaei, H., Ali, M., Street, D., Duc, G., Stoddard, F., Maalouf, F., Ogbonnaya, F. C., Link, W., Thomas, J. and O'Sullivan, D. M. (2015) A SNP-based consensus genetic map for synteny-based trait targeting in faba bean (Vicia faba L.). Plant Biotechnology Journal. ISSN 1467-7652 (In Press)
Map NV13 x Memphis
Linkage Group 1
Chromosome unknown
cM position 244.266
Assay ID
Assay Name Vf_Mt5g027980_001
Reference Allele Sequences
Sequence ID Allele Phenotype
C:C resistant
T:T susceptible
Polymorphism sequence GGTAGCATGGATTATGCTTGCTCAATTTTCACTCAAATGGATGAACCATGTAGCT
TTGATTACAATACAATGATTAGAGGGAGTGTTAATAACATGAGAT[Y]TGAAGAA
GCTTTGTCGATGTATGTTGAAATGCTTGAAAGAGGAATTSAGSCTGATAAATTCA
CTTATCCTTTTGTTCTCAAGGCTTGTTCTTT
Reference allele sequence alignment
Validation plot
Genotype data