NIAB - National Institute of Agricultural Botany

Assay information: Vf_Mt5g075490_001

Export assay as CSV

Narrative Viral A-type inclusion protein repeat containing protein expressed (AHRD V1 *-*- Q10RF6_ORYSJ); contains Interpro domain(s) IPR011684 KIP1-like chr05_pseudomolecule_IMGAG_V3.5 31108123-31104309 E EGN_Mt100125 20100825
References Webb, A., Cottage, A., Wood, T., Khamassi, K., Hobbs, D., Gostkiewicz, K., White, M., Khazaei, H., Ali, M., Street, D., Duc, G., Stoddard, F., Maalouf, F., Ogbonnaya, F. C., Link, W., Thomas, J. and O'Sullivan, D. M. (2015) A SNP-based consensus genetic map for synteny-based trait targeting in faba bean (Vicia faba L.). Plant Biotechnology Journal. ISSN 1467-7652 (In Press)
Map NV13 x Memphis
Linkage Group 1
Chromosome unknown
cM position 152.903
Assay ID
Assay Name Vf_Mt5g075490_001
Reference Allele Sequences
Sequence ID Allele Phenotype
T:T resistant
G:G susceptible
Polymorphism sequence TGGCAGAACGCTATGATCATGTGACTGGAGAGTTGCGGAAGAATGTACAAACTGA
TCTCCAATCTCAAGGCTCAGGTTTTTCAGACACCGGCTCTGAACC[K]TCTTCGA
CTTTGCCCTCTCCAAATGTAGCTCATACTAAATCTAGTAACCGAGCTGCTGGGTT
TGACTTCTTTCTGGGATCTGGTGGAAATGC
Reference allele sequence alignment
Validation plot
Genotype data