Narrative |
This KASP assay belongs to a set of 67 validated assays designed to recapitulate polymorphisms targeted by SNPshot or CAPS assays as described in Ellwood et al, BMC Genomics (2008). Further details of the validation of this set of KASP assays can be found in Cottage et al, Mol Breeding (2012) and the related online supplementary data. The assay has been integrated into a consensus map with 653 new markers. Details in Webb et al.,Plant Biotechnology Journal (2015). |
References |
Cottage A, Gostkiewicz K, Thomas JE, Borrows R, Torres A-M, and O Sullivan D.M. (2012) Heterozygosity and diversity analysis using mapped SNPs in a faba bean inbreeding programme. Molecular Breeding 30 (4). pp. 1799-1809. ISSN 1572-9788 doi: 10.1007/s11032-012-9745-4 . Ellwood S, Phan H, Jordan M, Hane J, Torres A, Avila C, Cruz-Izquierdo S, Oliver R (2008) Construction of a comparative genetic map in faba bean (Vicia faba L.); conservation of genome structure with Lens culinaris. BMC Genetics 9:380. |
Map |
2015 consensus map |
Linkage Group |
Vf_Chr_6 B |
Chromosome |
unknown |
cM position |
128.32 |
Assay ID |
972-0041 |
Assay Name |
HYPTE3SNP |
Reference Allele Sequences |
Sequence ID |
Allele |
Phenotype |
FH893745 |
T |
NA |
FH893876 |
A |
NA |
|
Polymorphism sequence |
ATCTGCTCTGTTGTTGCACCAAGCAGATTGGCTTTTATGGCTTCTTCATGGAAAG CTTGGAGTTTCAGATTATAATAATGCTCTGAAGGCATCATTTAATAAGCTCTAAC TTATTATCTGTTTTATAGCTATAGGGTAAATCATAATTATGTCTGTTGCGATATC CGAGTTGGAAAAT[W]TATCGATTGTTTTTATGTTTTGCAGGTTGGGTATGATCC TGAAGCTAACTCATATCCATCATGGCTAATCTCTC |
Reference allele sequence alignment |
|
Validation plot |
|
Genotype data |
Accession Name |
Other Ref |
Genotype call (with filter) |
Reference sample of known genotype |
|
Verde_Bonita |
T:A |
|
|
VF27 |
T:T |
|
|
ig11749-5/S1 |
A:A |
|
|
ig11903-1/S2 |
T:T |
|
|
ig11903-1/S3 |
T:T |
|
|
ig12137-2/S2 |
T:T |
|
|
ig12137-2/S3 |
T:T |
|
|
ig11276-1/S1 |
T:T |
|
|
ig12159-1/S1 |
T:T |
|
|
ig12159-1/S2 |
T:T |
|
|
ig12263-1/S1 |
T:T |
|
|
ig12263-1/S2 |
T:T |
|
|
ig12613-2/S2 |
T:T |
|
|
ig12613-2/S3 |
T:T |
|
|
ig12658-1/S1 |
T:T |
|
|
ig12658-1DW/S2 |
T:T |
|
|
ig12747-1/S1 |
T:T |
|
|
ig12747-2DW/S1 |
T:T |
|
|
ig12747-2/S2 |
T:T |
|
|
ig13004-1/S1 |
T:T |
|
|
ig11290-1/S1 |
T:T |
|
|
ig11290-1/S2 |
T:T |
|
|
ig14096-5/S1 |
T:A |
|
|
ig14189-1/S2 |
T:T |
|
|
ig14189-1/S3 |
T:T |
|
|
ig14197-2/S1 |
T:T |
|
|
ig14197-2/S2 |
T:T |
|
|
ig70718-5/S1 |
T:A |
|
|
ig72355-5/S1 |
T:A |
|
|
ig72423-1/S1 |
A:A |
|
|
ig72423-1/S2 |
A:A |
|
|
ig72495-1/S2 |
T:T |
|
|
ig124126-1/S1 |
A:A |
|
|
ig124126-1/S2 |
A:A |
|
|
ig124126-2/S1 |
A:A |
|
|
ig124126-2/S2 |
A:A |
|
|
ig124213-3/S1 |
T:T |
|
|
ig124300-1/S1 |
T:T |
|
|
ig124301-1/S1 |
T:T |
|
|
ig11531-5/S1 |
T:T |
|
|
ig130596-2/S1 |
T:T |
|
|
ig130596-2/S2 |
T:T |
|
|
ig130638-1/S1 |
T:T |
|
|
ig130674-1/S1 |
T:T |
|
|
ig130734-2/S1 |
T:T |
|
|
ig131693-1/S1 |
T:T |
|
|
ig131693-1/S2 |
T:T |
|
|
ig132660-2/S2 |
T:T |
|
|
ig132813-2/S1 |
A:A |
|
|
Borington Bulk-1 |
T:T |
|
|
Borington Bulk-1/S1 |
T:T |
|
|
V219-4/S1 |
T:T |
|
|
V220-3/S1 |
T:T |
|
|
NA1-2/S1 |
T:T |
|
|
NA12-1/S1 |
T:T |
|
|
Vf172-1 |
T:T |
|
|
Vf172-1/S1 |
T:T |
|
|
GLV45-2/S1 |
T:T |
|
|
Hedin/2-1 |
T:T |
|
|
Hedin/2-1/S1 |
T:T |
|
|
Maris Bead-3 |
T:T |
|
|
Maris Bead-3/S1 |
T:T |
|
|
Fuego-4 |
T:T |
|
|
Fuego-4/S1 |
T:T |
|
|
Granit-1 |
T:T |
|
|
Granit-1/S1 |
T:T |
|
|
Albus-1 |
T:T |
|
|
Kasztelan-1 |
T:T |
|
|
ig101760-3 (BPL1) |
T:T |
|
|
ig101760-3/S1 (BPL1) |
T:T |
|
|
ig101769-1/S1 (BPL10) |
T:T |
|
|
ig101769-1/S2 (BPL10) |
T:T |
|
|
ig101770-1/S1 (BPL11) |
? |
|
|
ig101770-1/S2 (BPL11) |
T:T |
|
|
ig101771-4/S1B1 (BPL12) |
T:T |
|
|
ig101771-3 (BPL12) |
T:T |
|
|
ig101780-3/S1 (BPL21) |
T:T |
|
|
ig101782-3 (BPL23) |
T:T |
|
|
ig101782-3/S1 (BPL23) |
T:T |
|
|
ig101786-2/S1 (BPL27) |
T:T |
|
|
ig101786-2/S2 (BPL27) |
T:T |
|
|
ig101799-1/S1 (BPL40) |
T:T |
|
|
ig101799-1/S3 (BPL40) |
T:T |
|
|
ig101822-2/S1 |
T:T |
|
|
ig101822-2/S2 (BPL63) |
T:T |
|
|
ig101942-3 (BPL183) |
T:T |
|
|
ig101942-3/S1 (BPL183) |
T:T |
|
|
CGN07715 cf-3-2 (60354-9) |
T:T |
|
|
CGN07715 cf-3-2 (60354-9)-1/S1A1 |
T:T |
|
|
FAB4000104-13-1 |
T:A |
|
|
FAB4000104-13-1/S1 |
T:A |
|
|
Vf6-1/S1 |
A:A |
|
|
Vf136-1/S1 |
T:T |
|
|
INRA29H-1/S1 |
A:A |
|
|
ig11656-6/S1 |
T:A |
|
|
ig11687-7/S1 |
T:T |
|
|
ig11695-5/S1 |
T:T |
|
|
NV153_1DW_S3A2 |
T:T |
|
|
NV639_1_HEDIN |
T:T |
|
|
NV643_3_S2 |
T:T |
|
|
NV644_1_KASZTEL |
T:T |
|
|
NV648_2_S3B2_7 |
T:T |
|
|
NV656_3_S2A2_9 |
T:T |
|
|
NV657_26 |
A:A |
|
|
NV658_2_CGN0771 |
T:T |
|
|
NV662_1_VF136 |
T:T |
|
|
NV713_1_COTEDOR |
A:A |
|
|
NV714_1_HIVERNA |
A:A |
|
|
NV715_1_WEBO |
A:A |
|
|
NV716_1_WIBO |
A:A |
|
|
NV717_1_L79_79 |
A:A |
|
|
NV718_1_L977_88 |
T:T |
|
|
NV719_1_L979_S1 |
T:T |
|
|
NV720_1_BOURDON |
T:T |
|
|
NV721_1_ARRISOT |
T:T |
|
|
NV722_1_BANNER |
T:T |
|
|
NV723_1_BULLDOG |
T:T |
|
|
NV724_1_PIETRAL |
T:T |
|
|
NV725_1_GIZA3_2 |
T:T |
|
|
NV726_1_GIZA402 |
A:A |
|
|
NV727_1_BPL4628 |
T:T |
|
|
NV728_1_TW |
T:T |
|
|
NV729_1_VF6 |
A:A |
|
|
NV730_1_I4347_4 |
A:A |
|
|
NV731_1_I4347_3 |
A:A |
|
|
NV732_1_BPL710 |
T:T |
|
|
NV733_1_NA112 |
T:T |
|
|
NV734_1_ILB938 |
T:T |
|
|
NV735_1_MELODIE |
A:A |
|
|
NV736_1_AURORA |
T:T |
|
|